Advanced Beginner/Intermediate Shell¶
Updated June 2018 by Ulas Karaoz
Credits¶
Original authors: Jessica Mizzi, Titus Brown, and Lisa K. Johnson at Lab for Data Intensive Biology (http://dib-training.readthedocs.io/en/pub/2016-01-13-adv-beg-shell.html)
Learning objectives:¶
- Expose you to a bunch of syntax around shell use & scripting.
- Show you the proximal possibilities of shell use & scripting.
- Give you some useful tricks
- Provide opportunity for discussion, so please ask questions!
Important
Before starting:
- Make sure you have the test data. Download and unpack:
wget https://s3-ap-southeast-1.amazonaws.com/mtb-bioinformatics-workshop-singapore/shell-data.zip
# will unzip a folder called `data`
unzip shell-data.zip
- Set your current working directory to be the top level dir:
cd ~/data/
- We’ll be posting code snippets to: https://public.etherpad-mozilla.org/p/mtb_bioinformatics_shell
- In this tutorial, commands are shown as
I am a command: you can type me in your shell terminal
.
Exploring directory structures¶
So, if we do ls
, we see a bunch of stuff. We didn’t create this folder.
How do we figure out what’s in it?
Here, find
is your first friend:
find . -type d
This walks systematically (recursively) through all files underneath ., finds all directories (type d), and prints them (assumed, if not other actions).
We’ll come back to find
later, when we use it for finding files.
Renaming a bunch of files¶
Let’s go into the IlluminaReads directory:
cd IlluminaReads
and take a look with ls
.
For our first task, let’s pretend that we want to change the extension of all of the fastq
files from *.fastq* to *.fq*. Here, we get to use two commands - for
and basename
.
for
lets you do something to every file in a list. To see it in action:
for i in *.fastq
do
echo $i
done
This is running the command echo
for every value of the variable i, which
is set (one by one) to all the values in the expression *.fastq.
If we want to get rid of the extension .fastq, we can use the basename
command:
for i in *.fastq
do
basename $i .fastq
done
Now, this doesn’t actually rename the files - it just prints out the name, with the suffix .fastq removed. To rename the files, we need to capture the new name in a variable:
for i in *.fastq
do
newname=$(basename $i .fastq).fq
echo $newname
done
What $( … ) does is run the command in the middle, and then replace the $( ) with the value of running the command.
Now we have the old name ($i) and the new name ($newname) and we’re ready
to write the rename command, which is mv
:
for i in *.fastq
do
newname=$(basename $i .fastq).fq
echo mv $i $newname
done
Question: why did we use ‘echo’ here?
Now that we’re pretty sure it all looks good, let’s run it for real:
for i in *.fastq
do
newname=$(basename $i .fastq).fq
mv $i $newname
done
We have renamed all the files!
Let’s also get rid of the annoying _001 that’s at the end of the
files. basename
is all fine and good with the end of files, but what
do we do about things in the middle? Now we get to use another useful command, cut
.
What cut
does is slide and dice strings. So, for example,
echo hello, world | cut -c5-
will give you o, world.
cut
expects to take a bunch of lines of input from a file. By
default it is happy to take them in from stdin (“standard input”), so
you can specify -` and give it some input via a pipe, which is what
we’re doing with echo:
We’re taking the output of echo hello, world
and sending it to the
input of cut with the |
command (pipe).
You’ve probably already seen this with head
or tail
, but many UNIX
commands take stdin and stdout.
Let’s construct the cut
command we want to use. If we look at the names of
the files, and we want to remove 001 only, we can see that each filename
has a bunch of fields separated by _. So we can ask cut
to pay attention
to the first four fields, and omit the fifth, around the separator (or
delimiter) _:
echo S194_L001_R1_001.fq | cut -d_ -f1-4
That looks about right, let’s put it into a for loop:
for i in *.fq
do
echo $i | cut -d_ -f1-4
done
Good, now assign it to a variable and append an ending:
for i in *.fq
do
newname=$(echo $i | cut -d_ -f1-4).fq
echo $newname
done
and now construct the mv
command:
for i in *.fq
do
newname=$(echo $i | cut -d_ -f1-4).fq
echo mv $i $newname
done
and if that looks right, run it:
for i in *.fq
do
newname=$(echo $i | cut -d_ -f1-4).fq
mv $i $newname
done
You’ve renamed all your files.
Let’s do something quite useful - subset a bunch of FASTQ files.
If you look at one of the FASTQ files with head
,
head S188_L001_R1.fq
you’ll see that it’s full of FASTQ sequencing records. Often we want to run a bioinformatices pipeline on some small set of records first, before running it on the full set, just to make sure all the commands work. So we would like to subset all of these files without modifying the originals.
First, let’s make sure the originals are read-only:
chmod u-w *.fq
Now, let’s make a subset directory:
mkdir subset
Now, to subset each file, we want to run a head
with an argument
that is the total number of lines we want to take. In this case, it
should be a multiple of 4, because FASTQ records have 4 lines each.
So let’s plan to take the first 100 lines of each file by using head
-400
.
The for loop will now look something like:
for i in *.fq
do
echo "head -400 $i > subset/$i"
done
If that command looks right, run it for real:
for i in *.fq
do
head -400 $i > subset/$i
done
We now have our subsets.
— Exercise: Can you rename all of your files in subset/ to have subset.fq at the end?
(Work in small groups; start from working code; there are several ways to do it, all that matters is getting there.)
Backtracking¶
Variables:
You can use either $varname or ${varname}. The latter is useful when you want to construct a new filename, e.g.:
MY${varname}SUBSET
would expand ${varname} and then put MY .. SUBSET on either end, while
MY$varnameSUBSET
would try to put MY in front of $varnameSUBSET which won’t work.
(Unknown/uncreated variables give nothing.)
(Variables are interpreted inside of “”, and not inside of ‘’.)
Pipes and redirection:¶
To redirect stdin and stdout, you can use:
> - send stdout to a file
< - take stdin from a file
| - take stdout from first command and make it stdin for second command
>> - appends stdout to a previously-existing file
stderr (for errors) can be redirected:
2> - send stderr to a file
and you can also say:
>& - to send all output to a file
Editing on the command line:¶
Most prompts support readline-style editing. This uses emacs control keys (emacs is a very powerful editor, tough with a bit of steep learning curve)
Type something out; then type CTRL-a. Now type CTRL-e. Beginning and end…
Up arrows to recall previous command, left/right arrows, etc.
Another useful command along with basename
is dirname
. Any idea what it does?
Working with collections of files; conditionals¶
Let’s go back to the data directory and play around with loops some more.
cd ..
if acts on things conditionally:
for i in *
do
if [ -f $i ]; then
echo $i is a file
elif [ -d $i ]; then
echo $i is a directory
fi
done
but what is the [ ] notation? That’s actually running
the test
command; try help test | less
to see the docs. This is a
syntax that lets you do all sorts of useful things with files –
We can use it to get rid of empty files:
touch emptyfile.txt
to create an empty file, and then:
for i in *
do
if [ \! -s $i ]; then
echo rm $i
fi
done
…and as you can see here, we are using ! to say ‘not’.
Executing things conditionally based on exit status¶
Let’s create two scripts (you can use nano
here if you want) – in
success.sh, put:
#! /bin/bash
echo mesucceed
exit 0
and in fail.sh, put:
#! /bin/bash
echo mefail
exit 1
You can do this with here documents. A here document (or heredoc) is a way of getting text input into a script without having to feed it in from a separate file.
cat > success.sh <<EOF
#! /bin/bash
echo mesucceed
exit 0
EOF
cat > fail.sh <<EOF
#! /bin/bash
echo mefail
exit 1
EOF
Now make them executable:
chmod +x success.sh fail.sh
(Somewhat counterintuitively, an exit status of 0 means “success” in UNIX.)
You can now use this to chain commands with && and ||:
./success.sh && echo this succeeded || echo this failed
./fail.sh && echo this succeeded || echo this failed
You can do this with R and python scripts too. In R, you set the exit status of a script with quit(status=0, save=’no’) and in Python with sys.exit(0). Any failure of the script due to an exception will automatically set the exit status to non-zero.
The exit status of the previous command can be examined with $?:
./success.sh
if [ $? -eq 0 ]; then echo succ; fi
./success.sh
if [ $? -ne 0 ]; then echo fail; fi
Writing shell scripts¶
Always put set -e
at the top.
Sometimes put set -x
at the top.
You can take in command line parameters with $1, $2, etc. $* gives you all of them at once.
Other bits and pieces¶
- You can use to do line continuation in scripts (in R and Python, too!)
- Scripts exit in a subshell and can’t modify your environment variables.
If you want to modify your environment, you need to use . or source.
Subshells are ways to group commands with ( … ).
screen lets you use multiple windows at the same time. It is extremely useful.
History tricks:
!! - run previous command !-1 - run command-before-previous command (!-2 etc.) !$ - replace with the last word on the previous line !n - run the nth command in your 'history'
A general approach you can use¶
- Break your task down into multiple commands
- Put commands in shell scripts, run in serial
- Use intermediate i/o files to figure out what’s going on!
- Use echo to debug!
More things you can do with find
¶
find
can be extremely flexible and powerful. Here is more useful things you can do with find
command:
Print all files:
find . -type f
Print all files w/details:
find . -type f -ls
Find all directories in the current directory:
find * -prune -type d -print
…and get their disk usage:
find * -prune -type d -exec du -skh {} \;
Here, -exec runs the command specified up until the ;, and replaces the {} with the filename.
Same result, different command:
find . -depth 1 -type d -exec du -skh {} \;
Find all files larger than 100k:
find . -size +100k -print
Find all files that were changed within the last 10 minutes:
find . -ctime -10m
(…and do things to them with -exec ;).
Run grep -l
to find all files containing the string ‘CGTTATCCGGATTTATTGGGTTTA’:
find . -type f -exec grep -q CGTTATCCGGATTTATTGGGTTTA {} \; -print
Note, you can use -a (and) and -o (or), along with ( and ), to group conditions:
find . \( \( -type f -size +100k \) -o \( -type f -size -1k \) \) -print
Note that you can exec
a Python, R, or shell script.
Exercise:
How would you copy all files containing a specific string (‘CGTTATCCGGATTTATTGGGTTTA’, say) into a new directory? And what are the pros (and cons) of your approach?
(Work in small groups; start from working code, say, the ‘find’ command above; there are several ways to do it, all that matters is getting there.)